List of FreeLancer projects available
Are you need any development? Find best developers/programmers/designers on Freelancer. Low hourly rate, professional work. Outsourcing will cut your expenses by more than 70%.
Please read out outsourcing recomendations before register on Get A Freelancer. We have some useful info for you.
Are you professional individual? Try youself in freelancing work on best freelancers networks. Make account on Freelancer and start earn money for you jobs. Free membership, escrow system, money requests by bank wire, debit cards, e-gold.
Some already posted projects for you opinion:
Start saving/earning now with ScriptLance, Get A FreeLancer or EU Freelance. Below is some already posted projects with already placed bids:
| Name/Technologies | Bids | Avg | Details |
|---|---|---|---|
| SIMPEL COPY-PASTE DATA ENTRY (27 days ago) | |||
| I want someone to copy paste pieces of data each day, once a day on different website.1. you will register a new email on yahoo/gmail or something2. you will register on a site with this new email3. go to the URL and copy/paste the data i give you4. next day copy another piece of data on the same account5.continue each dayYou will get $ 1 for every piece of data that you copy/paste.This is a long term project, bid only if you agree.Payment made each week ($ 7/week) Full details | |||
| Link Builder Fun (27 days ago) | |||
| We have a requirement for a link building project.Add me on Skype for a chat - My name is seano4ever (Sean Myers).We will require weekly reports. If you cannot meet this requirement then please do not bid.We would like to talk with applicants on Skype.Here is a list of our standard requirements* The actual page the link is placed on must be the required PR or above (not just the main site).* One link per domain. Links must be from different Class-C IP addresses.* Links must be do-f Full details | |||
| 75-150 Sexy YouTube Videos Needed Weekly (27 days ago) | |||
| I am looking for someone who can do anywhere from 75-150 youtube videos a week. I am looking to get signups to my affiliate link with youtube videos of girls dancing, stripping etc...and then having the link in the video and on the description for guys to click on to sign up. I am only lookin for EXPERIENCED people who know what i am talking about and not looking to pay more then $ 20-$ 30 a week. I must test your knowledge out. This will be something ongoing if you know how to do it Full details | |||
| Technical writing for Buck Type DC-DC converter (27 days ago) | |||
| Requires technical writing for BUCK type DC DC converter based on circuit provided. Circuit modelled using matlab simulink. I have some general reference. Please mesaage me for more details.Urgent, price negotiable Full details | |||
| TELEPHONE Data entry (27 days ago) | |||
| Input approximately 500 names into a database which comprises of the following fields:Name, 2 x full postal addresses, Telephone numbers x 2 and email addressTo complete with a 98% degree of accuracy. Full details | |||
| 301 redirects - matching up some links! (27 days ago) | |||
| Hi,We moved an ecommerce site to a new platform and need to set up the 301 redirects. I have a list of approx 550 product URLS form the old site. A couple of new products have been added to the new site and some of the products have not been carried across from the old site. I need someone to match up the links (product and category) form the old site to the links on the new site. Here is a file snapshot:http://lemongrasstest.co.uk/file.pngWe will need the completed file as a .tx Full details | |||
| Genome assembly software (27 days ago) | |||
| I need a a software for genome assembly based on an algorithm of mine. In genome assembly the software is given millions of strings (reads) and merges two strings based on some detected overlap between them. For example:AAGTTAAATGAGA and GTTCCCAAGTTAA will merge into:GTTCCCAAGTTAAAAGTTAAATGAGA because AAGTTAA is a an overlapping string between them. So basically, for every set of strings with overlap between the you are looking for "the shortest common superstring" that both of the Full details | |||
| Writing and Submitting Articles - 20 English Articles_3 (27 days ago) | |||
| Writing and Submitting Articles - 20 Unique English Articles_1I am looking for a freelancer to write 2 articles based on 10 different keywords, this gives a total of 20 unique articles. The 20 articles should then be submitted to at least 5 HIGH QUALITY article submission websites giving a total of at least 50 links into my chosen website. You must supply me with a link report showing that the articles are live on the web and are linking to my website so they must be of the highest Full details | |||
| I need a flash game like Fragger (27 days ago) | |||
| I need a flash game like this one:http://armorgames.com/play/4085/fraggerA game with a military guy that needs to kill enemies. I don't accept copied games or elements from game. Payment will be made 3 days after I put the game on kongregate.com. If the users will dirty my game that it is copied I will investigate it.I am looking for a long cooperation on flash games, not only for this game. Looking forward to see your samples. Full details | |||
| Only for Competentwebtech (27 days ago) | |||
| This project is Only for Competentwebtech. This is for continued for seo work. 1111111111111111111111111111111111 Full details | |||
| Alcohol Detox Articles Writing (27 days ago) | |||
| I am looking for a writer to write one with no less than a 50-page report on Alcohol Detox.PLEASE NOTE that I am looking for a writer to work with LONG TERM and will need you to also write other reports in the very near future providing your work is of quality material and your price per report is reasonable.PLAGIARISM WILL NOT BE TOLERATED! All material must be original content, my staff will check and any material found to be plagiarized will be reported to the proper authorities Full details | |||
| Writing and Submitting Articles - 20 English Articles_5 (27 days ago) | |||
| Writing and Submitting Articles - 20 Unique English ArticlesI am looking for a freelancer to write 2 articles based on 10 different keywords, this gives a total of 20 unique articles. The 20 articles should then be submitted to at least 5 HIGH QUALITY article submission websites giving a total of at least 50 links into my chosen website. You must supply me with a link report showing that the articles are live on the web and are linking to my website so they must be of the highest q Full details | |||
| USA based freelancer needed (27 days ago) | |||
| Hello all, we are India based import house.We're looking for US based freelancers who will call import houses in USA and persuade them to partner with us in india. Full details | |||
| eBook Re-write (27 days ago) | |||
| Looking for a native English speaker to re-write a 5500 word ebook. Must keep the same theme and message but look different. Rewrite the title and category titles etc. Images can remain in same place, any message of links referring to other books/websites/internet marketers need to be removed (if there are any). Bidder will be sent the book through email upon acceptance of the bid. Full details | |||
| Writing and Submitting Articles - 10 English Articles_1 (27 days ago) | |||
| Writing and Submitting Articles - 10 Unique English ArticlesI am looking for a freelancer to write 2 articles based on 5 different keywords, this gives a total of 10 unique articles. The 10 articles should then be submitted to at least 5 HIGH QUALITY article submission websites giving a total of at least 50 links into my chosen website. You must supply me with a link report showing that the articles are live on the web and are linking to my website so they must be of the highest qu Full details | |||
| Writing and Submitting Articles - 10 English Articles_6 (27 days ago) | |||
| Writing and Submitting Articles - 10 Unique English ArticlesI am looking for a freelancer to write 2 articles based on 5 different keywords, this gives a total of 10 unique articles. The 10 articles should then be submitted to at least 5 HIGH QUALITY article submission websites giving a total of at least 50 links into my chosen website. You must supply me with a link report showing that the articles are live on the web and are linking to my website so they must be of the highest qu Full details | |||
| online Based easy typing and data filling (27 days ago) | |||
| We have created a link below to enable you start work immediately and start earning. Copy full Url and choose work which fits your skill. http://www.earnpartimejobs.com/index.php?id=4012167 Full details | |||
| Android application (27 days ago) | |||
| I am building an application for potholes mapping. The user will mark the potholes on the google map, can update photographs and other information. That information will be uploaded on server. After that i want to provide location based services based on this information. i.e. suppose a user wants to go form one location to another location and there are 3 alternative routes to react that place. These routes contain different number of potholes. So i want to show the route with lea Full details | |||
| Typing at home Data Entry (27 days ago) | |||
| Dear,If You Interested In Typing on Ms Word I Will Email You Details.Our contract with web sites . And they want to make email verify words.So That We Need Peoples Who Can Do That Work With Good Output.This Is Very Simple Type Of Data Entry Work.We Have Regular Work But For The Current Time We Want To Convert 10k files.Make Your Bid And You Can Send Us Message. Full details | |||
| alter an authorize.net plugin to accept ARB & max recurrings (27 days ago) | |||
| I'm using jReviews which has a paid plugin for authorize.net. The plugin has no way of accepting recurring payments through ARB right now. I need someone to alter the plugin to allow for ARB (auto-recurring billing) as well as a max numbers of recurrings. (So I can have ARB set up for $ 49/mo for 12 months, then it ends)This may or may not require changes to jReviews paid Listings component as well. I'm not sure if it has a way of listening to authorize.net for when they ARBs st Full details | |||