List of Data Processing projects available
Start saving/earning now with ScriptLance, Get A FreeLancer or EU Freelance. Below is some already posted projects with already placed bids:
| Name/Technologies | Bids | Avg | Details |
|---|---|---|---|
| To modify the flashplayer of vowtube.com (24 days ago) | |||
| vowtube.com wants to modify the flashplayer to include the google adsenses inside the plashplayer and also all the properties flashplayer available on famous video hosting websites Full details | |||
| $ $ A Very Easy Typing Job $ $ (24 days ago) | |||
| Hello friend,I have 11 scanned pages of an English text book in jpg format.Each page contains 300 - 400 words.I need someone to manually type these 11 pages in MS Word format in exactly the same way as in the book.thanks Full details | |||
| online jobs (24 days ago) | |||
| online Data Entry Form Filling Projecti have a team of best data entry typing and have many workers of Online Data Entry Form Fillingif u have a project of Form Filling or have a Company projectSo tell me or bid me pleasei have a best workers for online data entry form fillingi need Unlimited Forms of Project Full details | |||
| $ =Easy Data Entry ( $ 10 Per Form )=$ (24 days ago) | |||
| Assist In Filling Online FormsI Am Looking For Self Motivated Individuals With Experience And Skills In Web,SEO Content For a Very Easy Task Of Filling Online Forms.(A). Visit The URLs(B). Register With The URLs(C). User LongingI Will Give You a Step By Step Guide to Follow.You Can Copy/Paste Text, I Will Select The Candidates With The Lowest Bid.Skills :. Typing, word, PDF, Data Entry, English Full details | |||
| Typing word (24 days ago) | |||
| My company have some old books. We can't scan to images.My company need one person who can do good this jobHave 5 booksOne book about 200 page1 page : 2 USDRequirement+ Good skill word+ Have responsbility+ On timeI will check your talent. And will start soonThanks Full details | |||
| Need Home Based Typist/Data Entry Clerks Positions Available (24 days ago) | |||
| We have several openings available in Data Entery area, earning ?250.00 - ?500.00 each week. We are seeking only honest, self- motivated people with a desire to work in the home typing and data entry field, from the comfort of their own homes. The preferred applicants should be at least 18 years old with Internet access. No experience is needed. We will provide you with training material and you continue working independantly. You will be responsible for your own work and time!Requ Full details | |||
| Data entry and Web research Job (24 days ago) | |||
| Do you love to surf the Internet? Then this job is maybe for you!I am looking for someone who is:-An internet pro who knows how to research and craw such internet resources-Able to work smart, be able to identify and seek relevant sources for such information-Curious and enjoy data mining and information extraction from the web-This position is result driven and pays well. Great compensation for the successful applicant/s-This a part-time job, so payment is contracted per job, with Full details | |||
| DATA SPECIALIST (24 days ago) | |||
| Data Specialist will work with data in excel and/or Google spreadsheets and manipulate it into a specified format. Candidate needs to be proficient in using excel and Google spreadsheets and needs to have at least 5 years of data and administrative experience. Work samples may need to be provided. Full details | |||
| Data Entry for Website (24 days ago) | |||
| I am looking for somebody to enter product information into a shopping cart software. Most of this job will consist of copy and pasting information from one site to another and uploading pictures. I will provide you with all of the information that is needed to perform the task. You must be able to communicate in English and be dependable. I will need this started immediately after I hire you. The max pay for this job is $ 1 per hour. I look forward to hiring a couple people to work Full details | |||
| Data Entry into Excel file (24 days ago) | |||
| We are looking for a person to look up the desired information on the internet, extract specific data, and enter the data into an Excel file. You will be looking for publicly available information, using search online and then crop/paste into Excel file. Accuracy is important.This job does not require any programming skills. A reliable internet connection, data entry skills are a must. If your work is accurate and your rate is good, then there could be many more similar projects, s Full details | |||
| DATA ENTRY PROFESSIONAL (24 days ago) | |||
| Looking for a group of hard working / smart data entry analysts to enter in various nutritional data on restaurant brands in the US (starbucks, chipotles, pret a manger, au bon pain). This is require strict discipline and precision. I will send detailed instructions when I hire the team. These instructions will include the the list of restaurants / brands, data sources and entry instructions. I am looking for a 3-4 weeks turnaround time.Web site content coding data entryweb site co Full details | |||
| Daily Deals Data Entry (24 days ago) | |||
| We are looking for experienced data entry expert with high tolerance of working daily graveyard shift. We prefer Filipino worker for a working hours that varies from 12am or 1am onwards. If you then willing to work during these hours and can work daily without any alibis then this job is for you. This is a long term job if we find you excel above our expectations. Job needs a high level of expertise in terms of quality. DO NOT APPLY IF YOU ALWAY COMMIT ERRORS and NOT COMMITTED TO Full details | |||
| Data Entry/Excel (24 days ago) | |||
| I need someone to help support some online administrative tasks. Good quality work delivered in timely manner will be rewarded with continued work. In essence i need a data entry person who can go to a number of social media sites create accounts and enter general personal details, activate accounts, upload photos and then set them up with some basic directions. Good understanding of the web is useful and an ability to work on their own. Simple work for a person with their heads sc Full details | |||
| Special Data Entry (24 days ago) | |||
| I'm in need of a data entry specialist that can learn quick. You will be receiving information through online file download. Your job will be to enter the information on a form into the database along with a photo(s). Should spend about 2 maybe 3 hours per day on data entry. Need someone to do this for about 11-12 days out of Full details | |||
| Data Entry Needed (24 days ago) | |||
| Read carefully before applying. This job is to transfer pdf file into a spreadsheet. You must have a knowledge in vlookup and formulas in excel because it's a lot of computation needed after transferring data into excel. You must be fluent in written english skill. Full details | |||
| BOOK TYPING AT HOME DATA ENTRY (24 days ago) | |||
| Dear,If You Interested In Typing a Book On Ms Word I Will Email You Details.Our contract with some publishers. And they want to make eBooks.So That We Need Peoples Who Can Do That Work With Good Output.This Is Very Simple Type Of Data Entry Work.We Have Regular Work But For The Current Time We Want To Convert 1,700 Pages.Make Your Bid And You Can Send Us Message Then I Will Providing Projects Detail. Full details | |||
| Need Data Entry (24 days ago) | |||
| Hi,I need US, CA or UK data entry asap. Just fill up the form and it is good for anyone even you are new in freelance. Im welcome you to bid and I only consider the lower bid and the country i list. Full details | |||
| Data Entry: SAT Practice Tests (24 days ago) | |||
| I run a tutoring company that helps students prepare for standardized tests.Job description:I need a person or firm to enter responses from bubble sheets for SAT practice exams that have been completed by our students. All questions are multiple choice and the responses will need to be entered through the student section.Specific data for project:You will be provided with scanned copies of answer sheets for 16 students. Each answer sheet has approximately 160 multiple choice questi Full details | |||
| TELEPHONE Data entry (24 days ago) | |||
| Input approximately 500 names into a database which comprises of the following fields:Name, 2 x full postal addresses, Telephone numbers x 2 and email addressTo complete with a 98% degree of accuracy. Full details | |||
| Genome assembly software (24 days ago) | |||
| I need a a software for genome assembly based on an algorithm of mine. In genome assembly the software is given millions of strings (reads) and merges two strings based on some detected overlap between them. For example:AAGTTAAATGAGA and GTTCCCAAGTTAA will merge into:GTTCCCAAGTTAAAAGTTAAATGAGA because AAGTTAA is a an overlapping string between them. So basically, for every set of strings with overlap between the you are looking for "the shortest common superstring" that both of the Full details | |||
Our partners scimilar projects list for Data Processing or mistersoft.org projects related to Data Processing work